Techniques : Comment on a séquencé.

Protocole de séquençage de la région HVS1 de l’ADN mitochondrial humain

En bref :

Prélèvement par cyto-brosse, purification de l’ADN total, amplification du fragment d’intérêt (entre 16060 et 16360) par PCR puis séquençage Sanger.

Opération réalisée gracieusement par Patrick Descombes, responsable de la Plateforme Génomique du NCCR «Frontiers in Genetics et Colette Rossier responsable du service de séquençage d’ADN au CMU, d’après un protocole mis au point par les équipes de l’UPGM, dirigée par Yamama Naciri, aux Conservatoire et Jardin Botaniques, Ville de Genève, et de l’AGP, dirigé par A. Sanchez-Mazas, à l’Université de Genève.

Prélèvement de l’échantillon

La cyto-brosse permet de prélever des cellules de la peau dans la bouche). Ces cellules contiennent l’ADN génomique et mitochondrial.

  • Ouvrir une sachet contenant la cyto-brosse
  • Ne rien toucher avec l’embout destiné au prélèvement (contaminations)!
  • Frotter env 1 minute les parois intérieures des joues et gencives. Appliquer une certaine pressions (sans vous blesser!).
  • Insérer la cyto-brosse dans le tube et briser la tige à l’endroit marqué
  • Refermer avec le capuchon

Suites des étapes effectuées en laboratoire

Extraction d’ADN

  • Ajouter au tube 500 µl de solution de lyse (LS) et 20 µl de protéinase K, et incuber 1 heure à 60°C

La solution LS contient un détergent qui va lyser les cellules, la protéinase K est une protéase (enzyme) qui va digérer les protéines dans le lysat.

  • Transférer 400 µl de lysat dans un tube eppendorf, ajouter 400 µl de solution CT, bien mélanger.

Cette solution contient des sels et va permettre faire précipiter l’ADN , que l’on peut ensuite récupérer par simple centrifugation.

  • Centrifuger 7 minutes à 13’000 tours/minute, enlever le liquide surnageant, re-centrifuger quelques secondes pour bien pourvoir éliminer les traces de solution
  • Reprendre l’ADN précipité dans 150 de solution rampon (Tris-HCl-EDTA) et laisser resuspendre qqs minutes

Amplification par PCR
Toujours travailler dans une pièce pré-PCR (contaminations).
Amorces utilisées lors de l’amplification et de la réaction de séquençage
Primer Forward L15996             5’‐CTCCACCATTAGCACCCAAAGC‐3’
Primer Reverse H16401             5’‐TGATTTCACGGAGGATGGTG‐3’

Préparation de la PCR

Les amorces sont à une concentration de 100 µM!
Mélanger dans un tube de 200 µl (paroi fine):
pour 1 PCR   Mix pour 10 PCR
2 x mix PCR JumpStart ReadyMix (Sigma Cat No P0982)   25 µl          250 µl
Primer Forward L15996                                                               0.5 µl              5 µl
Primer Reverse H16401                                                                0.5 µl              5 µl
H2O                                                                                                    23 µl          230 µl
A 49 µl de mix, ajouter 1 µl d’ADN

Réaction de PCR:

  • 94°C 2′
    • 94°C 30 »
    • 60°C 30 »                  30 x
    • 72°C 30 »
    • 72°C 5′
  • 4°C

Prélever 5 µl et analyser par électrophorèse sur gel agarose 1.5 %: ceci permet de vérifier que l’amplification a bien eu lieu.
Fig 3 : les ADN ont été amplifiés et le fait qu’il y ait une seule bande montre que la PCR a bien « pêché » une seule séquence : les amorces ont bien été sélectives.

Purification du produit de PCR

Avant de pouvoir séquencer, il faut purifier les fragments amplifiés en enlevant les restes de déoxynucléotides et d’amorces non incorporées.

Ceci s’effectue simplement par digestion avec une phosphatase qui va déphosphoryler les deoxynucléotides et les rendre impropres à l’incorporation, et en digérant les amorces avec une exonuclease qui va les dégrader.

Purification de produit de PCR en utilisant Exo‐SAP

0.5μl ExoNuclease I
0.5 μl SAP(phosphatase)
2 μl Buffer SAP
5 ul de produit de PCR
12 μl H2O

Séquençage Sanger

Amplification à partir d’une des amorce de PCR en présence de Taq polymerase et d’un mélange de deoxynucléotides et de dideoxynucléotides (chaque di deoxynucléotide est parqué avec un fluorophore différent).
Précipitation de l’ADN, resuspension dans un tampon dénaturant (formamide) pour séparer les deux brins.
Chargement sur un appareil pour électrophorèse capillaire pour séparer les fragments par taille.
Lecture des bases sortant du capillaire avec un laser et une caméra

Cette phase a été effectuée – gratuitement !  merci à elle – par Colette Rossier responsable du service de séquençage d’ADN au CMU.

Les données !

Les résultats : des séquences mélangées a d’autres , soit au total une 60aine de séquences sont disponibles [TXT]ici.txt aux membres S’inscrire à Expériment@l ?

Il s’agit de la séquence de HVS1 soit les positions 16060 à 16360 sauf un petit bout de 11 paires de bases.

La glissade qui brouille le séquençage

Estella Poloni  note que  « pour 3 séquences  ça a visiblement glissé vers 16180. »

Cela signifie qu’une séquence avec une longue suite de C pose problème au séquençage Sanger qui « glisse » et la suite n’est pas fiable. De ce fait cette zone (environ 11 pb, des positions 16183 à 16193 inclues) est ignorée pour l’analyse du polymorphisme.
Pour comprendre pourquoi, car c’est typiquement le genre de Q° qu’un élève malin peut poser, faisant preuve d’un esprit scientifique, qu’on ne voudrait pas étouffer, -> La glissade du séquençage qui rend flou

Références

Bendall, K. E., & Sykes, B. C. (1995). Length heteroplasmy in the first hypervariable segment of the human mtDNA control region. American journal of human genetics, 57(2), 248. pdf

Cette entrée a été publiée dans AuthenTIC Data : des données authentiques pour la classe, avec comme mot(s)-clef(s) , , . Vous pouvez la mettre en favoris avec ce permalien.

Les commentaires sont fermés.